View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15214_high_4 (Length: 337)
Name: NF15214_high_4
Description: NF15214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15214_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 92 - 319
Target Start/End: Complemental strand, 34119308 - 34119081
Alignment:
| Q |
92 |
cattgccatgcctaagtaaagtaagtacatgtaagtcaaatcacacaattttgtcacttatcacttttatcctggctgaaacatataaggcgattgaacc |
191 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34119308 |
cattggcatggctaagtaaagtaagtacatgtaagtcaaatcacgcaattttgtcacttatcacttttatcctggctgaaacatataaggcgattgaacc |
34119209 |
T |
 |
| Q |
192 |
tgaaacaatggagaagaaagaattggaagctagagtagttagcaaagttgcagaagtaatatcagctataaagaacgccaagcacgttgatcatgtcatt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34119208 |
tgaaacaatggagaagaaagaattggaagctagagtagttagcaaagttgcagaagtaatatcagctataaagaacgccaagcacgttgatcatgtcatt |
34119109 |
T |
 |
| Q |
292 |
tcttcacttcactccatcgccactcttc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34119108 |
tcttcacttcactccatcgccactcttc |
34119081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University