View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15215_high_15 (Length: 300)
Name: NF15215_high_15
Description: NF15215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15215_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 15 - 282
Target Start/End: Complemental strand, 21434969 - 21434702
Alignment:
| Q |
15 |
tatagatttgaagcaaaaggcatgcgcaagatcaaacgagcgattcaatacttgagcttctgccattgttgcatcttccgttcctttggttttccaattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21434969 |
tatagatttgaagcaaaaggcatgcgcaagatcaaacgagcgattcaatacttgagcttctgccattgttgcatcttccgttcctttggttttccaattt |
21434870 |
T |
|
| Q |
115 |
tccgcagcaaccacatttctacttgcaaccctaatatcactgtactaagaccccagtgaccttccatgtgaaggtttgcatcacaatttgccttatagaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21434869 |
tccgcagcaaccacatttctacttgcaaccctaatatcactgtactaagaccccagtgaccttccatgtgaaggtttgcatcacaatttgccttatagaa |
21434770 |
T |
|
| Q |
215 |
attgaggagcaaccctttagatttttgcttgttattgtctcttatctcaaaaatttccctttcacgtt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21434769 |
attgaggagcaaccctttagatttttgcttgttattgtctcttatctcaaaaatttccctttcacgtt |
21434702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University