View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15215_high_19 (Length: 209)
Name: NF15215_high_19
Description: NF15215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15215_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 192
Target Start/End: Original strand, 1166910 - 1167084
Alignment:
| Q |
18 |
aatagtggataaagcctcaacttatatccattaagaaaaatagtctataacaacatcaataaatttaatttgacttggtcttggaggaattggtccaagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1166910 |
aatagtggataaagcctcaacttatatctattaagaaaaatagtctataacaactacaataaatttaatttgacttggtcttggaggaattggtccaacg |
1167009 |
T |
 |
| Q |
118 |
atatcactcccccaagttttgaaggtccatgtaatcactatgtgatatgaatgattggcaaacctctgatactct |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1167010 |
atatcactcccccaagttttgaaggtccatgtaatcactatgtgatatgaatgattggtaaacctctgatactct |
1167084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University