View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15217_high_26 (Length: 377)
Name: NF15217_high_26
Description: NF15217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15217_high_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 11 - 360
Target Start/End: Original strand, 30025576 - 30025941
Alignment:
| Q |
11 |
tatattcaatttaaattaaattaagcataattttgcgtgtcat----tgaccataaagataaattgaacgtccatgaaattttattttnnnnnnnn---- |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| ||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
30025576 |
tatattcaatttaaattaaattaagcataattttgcatgtcatatattgaccattaagagaaattgaacgtccatgaaattttattttttattttaaaaa |
30025675 |
T |
|
| Q |
103 |
--gttgggaatttgatttggtttagaagagataaaatttgtgtgtgagagaggagaggaagttacctgcaatgttagagatgaggaagagggtaaggatg |
200 |
Q |
| |
|
||||||||| |||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30025676 |
aagttgggaatgtgatgtggtttagaagagagaaaatttgtgtgtgagagaggagaggaagttacctgcaatgttagagatgaggaagagggtaaggatg |
30025775 |
T |
|
| Q |
201 |
agtcttagcattgtggtgattggaatgaag-------tgcttcttatgtgtttgctacttgcttttgatatattatagggatagcaaaccgttgcttttt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30025776 |
agtcttagcattgtggtgattggaatgaagaatgaagtgcttcttatgtgtttgctacttgcttttgatatattatagggatagcaaaccgttgctttt- |
30025874 |
T |
|
| Q |
294 |
atagggacaaagggtgtggaccaagtaaatggaactgcaaaacagacacaacatggaatggagatgg |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30025875 |
atagggacaaagggtgtggaccaagtaaatggaactgcaaaacagacacaacatggaatggagatgg |
30025941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University