View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15217_high_37 (Length: 302)
Name: NF15217_high_37
Description: NF15217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15217_high_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 37573454 - 37573351
Alignment:
| Q |
4 |
tctccttaccacgtgtctcttctgcaccgttatcatttcaaacaagatgaaataacttcataaagactcaatgccctaaccaattgtgtaatcaacttct |
103 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37573454 |
tctccttaccacgtgtctctcctgcaccgttatcatttcaaacaagatcga------tcataaagactcaatgccctaaccaattgtgtaatcaacttct |
37573361 |
T |
 |
| Q |
104 |
aattttacta |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
37573360 |
aattttacta |
37573351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University