View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15217_high_42 (Length: 270)
Name: NF15217_high_42
Description: NF15217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15217_high_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 260
Target Start/End: Complemental strand, 47918661 - 47918429
Alignment:
| Q |
18 |
acataaaaactctttcacttcagatagaattggacagaaataaacgtg-agaaaatggaaagnnnnnnntataatcttgatttatattactaatactctg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | | |||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47918661 |
acataaaaactctttcacttcagatagaattggacagaaataaatatacataaaa---aaa--------tataatcttgatttatattactaatactctg |
47918573 |
T |
|
| Q |
117 |
actgcaattttttataatatcatagattgcagcagcaatttcaaaagcttaattagtacctgaattatgccggaatggtcaccctttgagtgcttttcga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47918572 |
actgcaattttttataatatcatagattgcagcagcaatttcaaaagcttaattagtacctgaattatgccggaatggtcaccctttgagtgcttttcga |
47918473 |
T |
|
| Q |
217 |
acctttataggctcaacaggttcatctcccctattttgtctctg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47918472 |
acctttataggctcaacaggttcatctcccctattttgtctctg |
47918429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 18 - 210
Target Start/End: Original strand, 29918503 - 29918694
Alignment:
| Q |
18 |
acataaaaactctttcacttcagatagaattggacagaaataaacgtgagaaaatggaaagnnnnnnntataatcttgatttatattactaatactctga |
117 |
Q |
| |
|
||||||||| |||| ||||||| ||||||||||||| ||||| ||||||||||||||| | |||||||||||||||||||||| |||| | |
|
|
| T |
29918503 |
acataaaaagtctt-cacttcacatagaattggacataaataggtgtgagaaaatggaaa---ataatttgaatcttgatttatattactaattctctaa |
29918598 |
T |
|
| Q |
118 |
ctgcaattttttataatatcatagattgcagcagcaatttcaaaagct---taattagtacctgaattatgccggaatggtcaccctttgagtgct |
210 |
Q |
| |
|
||| | ||||||||||| |||||||| |||||||||||||||||| | || ||||||||||||||||||| | |||||||||| ||||||||| |
|
|
| T |
29918599 |
ctgaatttttttataatttcatagatcacagcagcaatttcaaaagtttagtacttagtacctgaattatgccagcatggtcaccccttgagtgct |
29918694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 207 - 260
Target Start/End: Original strand, 29918750 - 29918803
Alignment:
| Q |
207 |
tgcttttcgaacctttataggctcaacaggttcatctcccctattttgtctctg |
260 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29918750 |
tgctttttgaacctttataggctcaacaggttcatcacccctattttgtctctg |
29918803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University