View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15217_low_32 (Length: 345)
Name: NF15217_low_32
Description: NF15217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15217_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 27 - 269
Target Start/End: Original strand, 39471318 - 39471560
Alignment:
| Q |
27 |
tgtaaaactagattgttgttattatcttgttggaattatttattattcaataatannnnnnnnnnnnnnnnnnnnggcatgcgtatttcaaaggacaatg |
126 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
39471318 |
tgtaaaactggattgttgttattatcttgttggaattatttattattcaataatatgtgtggtgtgtggtgtgtgggcatgcgtatgacaaaggacaatg |
39471417 |
T |
|
| Q |
127 |
cagtgcaggctaccacttgtttttactatatatggatgtggactgttttggagctttgtagacctgtatttttgacatggtcctgactgcaattttatgt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39471418 |
cagtgcaggctaccacttgtttttactatatatggatgtggactgttttggagctttgtagacctgtatttttgacatggtcctgactgcaattttatgt |
39471517 |
T |
|
| Q |
227 |
tacttatatttgtgttattttccaaatataatcttatcaggtg |
269 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39471518 |
ttcttatatttgtgttattttccaaatataatcttatcaggtg |
39471560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 158 - 199
Target Start/End: Original strand, 39465092 - 39465133
Alignment:
| Q |
158 |
atggatgtggactgttttggagctttgtagacctgtattttt |
199 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
39465092 |
atggatatgaactgttttggagctttgtagacctgtattttt |
39465133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University