View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15217_low_39 (Length: 300)
Name: NF15217_low_39
Description: NF15217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15217_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 11 - 283
Target Start/End: Original strand, 24046736 - 24047008
Alignment:
| Q |
11 |
ataatatgctaaaggagtgtattagaagggtttactcttggtcacatttatgaccaactatgtatgtacttaaacttaaagttttacttaggtaactact |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24046736 |
ataatatgctaaaggagtgtattagaagggtttactcttggtcacatttatgatcaagtatgtatgtacttaaacttaaagttttacttaggtagctact |
24046835 |
T |
|
| Q |
111 |
aatgttaatagacaatgtattgttttctannnnnnngttcaggtattctcaaattgtttgaggtcaagtgggaggacagggattatagcatcagaggaag |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24046836 |
aatgttaatagacaatgtattgttttctatttttttgttcaggtattctcaaattgtttgaggtcaagtgggaggacagggattatagcatcagaggaag |
24046935 |
T |
|
| Q |
211 |
aggatgtgccagtggcagtagaagagagttattcaggaaactacattgtggtctttgatccacttgatggttc |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24046936 |
aggatgtgccagtggcagtagaagagagttattcaggaaactacattgtggtctttgatccacttgatggttc |
24047008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University