View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15217_low_43 (Length: 271)
Name: NF15217_low_43
Description: NF15217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15217_low_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 82 - 249
Target Start/End: Complemental strand, 3222081 - 3221918
Alignment:
| Q |
82 |
caagtgatgagtagacatgatgtgtgtgttgataggtggaacttgggagtttaaggtagctaggtagcaagtcaaaggagaggcaaacagacgaaaatga |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3222081 |
caagtgatgagtagacatgatgtgtgtgttgataggtggaacttgggagtttaaggtag----gtagcaagtcaaaggagaggcaaacagacgaaaatga |
3221986 |
T |
|
| Q |
182 |
catctctaaagattcccactaatggatgaatggcatatttcgaactacttgagattctttcttccata |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
3221985 |
catctctaaagattcccactaatggatgaatggcatatttcaaactacttgagattcttccttccata |
3221918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 217
Target Start/End: Original strand, 3186435 - 3186498
Alignment:
| Q |
154 |
caaaggagaggcaaacagacgaaaatgacatctctaaagattcccactaatggatgaatggcat |
217 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||| ||||||||||||||||||| ||||||| |
|
|
| T |
3186435 |
caaaggagaggcaaagagacagaaatgacttctcttgagattcccactaatggatgcatggcat |
3186498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University