View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15217_low_50 (Length: 232)
Name: NF15217_low_50
Description: NF15217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15217_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 16 - 160
Target Start/End: Original strand, 37573435 - 37573586
Alignment:
| Q |
16 |
agagacacgtggtaaggagatattagagagagattgtacacacgtacgtacagtacagctagctagctgtgcgagggagtgagtgagcagtaaacaatg- |
114 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37573435 |
agagacacgtggtaaggagagattagagagagattgtacacacgtacgtacagtacagctagctagctgtgcgagggagtgagtgagcagtaaacaatgg |
37573534 |
T |
 |
| Q |
115 |
---gtttgttatgtc---tcttcttctgctgtagccgttttgtgcagtgcag |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37573535 |
tttgtttgttatgtctcttcttcttctgctgtagccgttttgtgcagtgcag |
37573586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University