View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15217_low_53 (Length: 225)
Name: NF15217_low_53
Description: NF15217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15217_low_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 5516437 - 5516615
Alignment:
| Q |
18 |
atgaagtagacctgaagccaataaatatataccttttgagcaaatttagctttgattttatctccctcaaactcgtttttgttccattcctgacctgtgg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5516437 |
atgaagtagacctgaagccaataaatatataccttttgagcaaatttcgctttgattttatctccctcaaactcgtttttgttccattcctgacctgtag |
5516536 |
T |
|
| Q |
118 |
taacaattgtggtattttagattgtttatggttcggttcaagaagaaaattaaaccaaactgaactgttactatagttc |
196 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5516537 |
taacaactgtggtattttagattgtttatggttcggttcaagaagaaaactaaaccaaactgaactgttactatagttc |
5516615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 187
Target Start/End: Original strand, 36927989 - 36928031
Alignment:
| Q |
145 |
atggttcggttcaagaagaaaattaaaccaaactgaactgtta |
187 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
36927989 |
atggttcggtttgagatgaaaattaaaccaaactgaactgtta |
36928031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University