View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15217_low_57 (Length: 205)
Name: NF15217_low_57
Description: NF15217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15217_low_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 21 - 170
Target Start/End: Original strand, 37664050 - 37664199
Alignment:
| Q |
21 |
gaaaacagattgatgccagcagaaacgccaatatcgactagagttgccattttcttctccctttaaaacacactttaacctacacatatttnnnnnnnta |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37664050 |
gaaaacagattgatgccagcagaaacgccaatatcgactagagttgccattttcttctccctttaaaacacactttaacctacacatatttaaaaaaata |
37664149 |
T |
 |
| Q |
121 |
agtcatgaaattggctttccgatttcaagtagcatgacttctaaattcat |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37664150 |
agtcatgaaattggctttccgatttcaagtagcatgacttctaaattcat |
37664199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University