View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1521_low_1_N (Length: 490)

Name: NF1521_low_1_N
Description: NF1521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1521_low_1_N
NF1521_low_1_N
[»] chr7 (1 HSPs)
chr7 (271-454)||(1632162-1632345)
[»] chr6 (1 HSPs)
chr6 (296-369)||(26593429-26593502)
[»] chr2 (1 HSPs)
chr2 (330-396)||(17150364-17150430)


Alignment Details
Target: chr7 (Bit Score: 164; Significance: 2e-87; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 271 - 454
Target Start/End: Original strand, 1632162 - 1632345
Alignment:
271 tgaggtaatgattgagatgtaaggtttttctttttcaatcgaaattatttatgaaagattgccggcattttgcacccactgtagaaacattggacatcac 370  Q
    ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1632162 tgaggtaatgattgagagggaaggtttttctttttcaatcgaaattatttatgaaagattgccggcattttgcacccactgtagaaacattggacatcac 1632261  T
371 attacctattgtcggtggctgcaccccaccaatgttactcacatgactgacaaacagaagaaaattgtcctacagaaacagcag 454  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |||||||||||||    
1632262 attacctattgtcggtggctgcaccccaccaatgttactcacgtgactgacaaacagaaaaaaattgtcccacagaaacagcag 1632345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 296 - 369
Target Start/End: Complemental strand, 26593502 - 26593429
Alignment:
296 ttttctttttcaatcgaaattatttatgaaagattgccggcattttgcacccactgtagaaacattggacatca 369  Q
    |||||||||||||| || ||||  |||||| | |||||||| |||||||| |||||| | ||||||||||||||    
26593502 ttttctttttcaattgagattacctatgaacgtttgccggcgttttgcacacactgtgggaacattggacatca 26593429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 330 - 396
Target Start/End: Original strand, 17150364 - 17150430
Alignment:
330 tgccggcattttgcacccactgtagaaacattggacatcacattacctattgtcggtggctgcaccc 396  Q
    ||||| |||||||||| |||||||  |||||||||||||| |||||   |||||| |||||||||||    
17150364 tgccgtcattttgcactcactgtaagaacattggacatcatattacaagttgtcgatggctgcaccc 17150430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University