View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1521_low_1_N (Length: 490)
Name: NF1521_low_1_N
Description: NF1521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1521_low_1_N |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 2e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 271 - 454
Target Start/End: Original strand, 1632162 - 1632345
Alignment:
| Q |
271 |
tgaggtaatgattgagatgtaaggtttttctttttcaatcgaaattatttatgaaagattgccggcattttgcacccactgtagaaacattggacatcac |
370 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1632162 |
tgaggtaatgattgagagggaaggtttttctttttcaatcgaaattatttatgaaagattgccggcattttgcacccactgtagaaacattggacatcac |
1632261 |
T |
|
| Q |
371 |
attacctattgtcggtggctgcaccccaccaatgttactcacatgactgacaaacagaagaaaattgtcctacagaaacagcag |
454 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
1632262 |
attacctattgtcggtggctgcaccccaccaatgttactcacgtgactgacaaacagaaaaaaattgtcccacagaaacagcag |
1632345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 296 - 369
Target Start/End: Complemental strand, 26593502 - 26593429
Alignment:
| Q |
296 |
ttttctttttcaatcgaaattatttatgaaagattgccggcattttgcacccactgtagaaacattggacatca |
369 |
Q |
| |
|
|||||||||||||| || |||| |||||| | |||||||| |||||||| |||||| | |||||||||||||| |
|
|
| T |
26593502 |
ttttctttttcaattgagattacctatgaacgtttgccggcgttttgcacacactgtgggaacattggacatca |
26593429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 330 - 396
Target Start/End: Original strand, 17150364 - 17150430
Alignment:
| Q |
330 |
tgccggcattttgcacccactgtagaaacattggacatcacattacctattgtcggtggctgcaccc |
396 |
Q |
| |
|
||||| |||||||||| ||||||| |||||||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
17150364 |
tgccgtcattttgcactcactgtaagaacattggacatcatattacaagttgtcgatggctgcaccc |
17150430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University