View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1521_low_2 (Length: 263)

Name: NF1521_low_2
Description: NF1521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1521_low_2
NF1521_low_2
[»] chr5 (1 HSPs)
chr5 (16-249)||(36823311-36823538)


Alignment Details
Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 16 - 249
Target Start/End: Complemental strand, 36823538 - 36823311
Alignment:
16 gcatatctgtaggcctcattcttcctattcaaacacaattcgatcaaaatgaggttactatatggagcatacggggaaaagagattggaacatttcattt 115  Q
    |||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||    
36823538 gcatatatgtaggcctcattcttcctattcaaacacaattcaatcaaaatgaggttac-atatggagcatacgag-aaaagagattggaacatttcattt 36823441  T
116 atgaatcactacttagtgacataactaacacacgcgcacacgcgcgcgcacacatacagaaacacttcactcatacaaaaacagcagcataaaattataa 215  Q
    |||||||||||||||||||||||||||||||||||||    |||| | |||||| |||||||||||||||||||||||||||||||||||||||||||||    
36823440 atgaatcactacttagtgacataactaacacacgcgc----gcgcacacacacacacagaaacacttcactcatacaaaaacagcagcataaaattataa 36823345  T
216 tcctcacatctagaaagacccaaacacaaatttg 249  Q
      ||||||||||||||||||||||||||||||||    
36823344 ctctcacatctagaaagacccaaacacaaatttg 36823311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University