View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1521_low_2 (Length: 263)
Name: NF1521_low_2
Description: NF1521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1521_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 16 - 249
Target Start/End: Complemental strand, 36823538 - 36823311
Alignment:
| Q |
16 |
gcatatctgtaggcctcattcttcctattcaaacacaattcgatcaaaatgaggttactatatggagcatacggggaaaagagattggaacatttcattt |
115 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
36823538 |
gcatatatgtaggcctcattcttcctattcaaacacaattcaatcaaaatgaggttac-atatggagcatacgag-aaaagagattggaacatttcattt |
36823441 |
T |
|
| Q |
116 |
atgaatcactacttagtgacataactaacacacgcgcacacgcgcgcgcacacatacagaaacacttcactcatacaaaaacagcagcataaaattataa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| | |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36823440 |
atgaatcactacttagtgacataactaacacacgcgc----gcgcacacacacacacagaaacacttcactcatacaaaaacagcagcataaaattataa |
36823345 |
T |
|
| Q |
216 |
tcctcacatctagaaagacccaaacacaaatttg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36823344 |
ctctcacatctagaaagacccaaacacaaatttg |
36823311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University