View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1521_low_9 (Length: 270)

Name: NF1521_low_9
Description: NF1521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1521_low_9
NF1521_low_9
[»] chr1 (1 HSPs)
chr1 (32-223)||(52153025-52153216)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 32 - 223
Target Start/End: Complemental strand, 52153216 - 52153025
Alignment:
32 atactaatttggcattcaactatttgggtcgcggtttttgagtgtttaaggaaggctggtgttgggttggcaggttggtgtgtttctgcaggggtgttct 131  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
52153216 atactaatttggcattcaactatttgggtcgcggtttttgagtgtttaagggaggctggtgttgggttggcaggttggtgtgtttctgcaggggtgttct 52153117  T
132 ttcaagctgctgcctggtgtagtttggagttatcaatgccttgtttttatgccgtagagagtctggcgtgggttctgtagttggccgattct 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52153116 ttcaagctgctgcctggtgtagtttggagttatcaatgccttgtttttatgccgtagagagtctggcgtgggttctgtagttggccgattct 52153025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University