View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15221_low_3 (Length: 204)
Name: NF15221_low_3
Description: NF15221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15221_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 1340024 - 1339846
Alignment:
| Q |
17 |
caaaggcttgtcgaagaacaaattgacaaaaagattgttttgtcaatgagagctatttatcagtcaaaaataggtcttggtctaatggacataggtatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1340024 |
caaaggcttgtcgaagaacaaattgacaaaaagattgttttgtcaatgagagctatttatcagtcaaaaataggtcttggtctaatggacataggtatgt |
1339925 |
T |
|
| Q |
117 |
gggttgtttatttctttctttcttttaatagttgaaagaaattgtaggctaaatgtatatttgacaggattgatgatgt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1339924 |
gggttgtttatttctttctttcttttaatagttgaaagaaattgtaggctaaatgtatatttgacaggattgatgatgt |
1339846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University