View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15222_low_10 (Length: 271)
Name: NF15222_low_10
Description: NF15222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15222_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 258
Target Start/End: Original strand, 1795567 - 1795805
Alignment:
| Q |
18 |
agaatgaccccctgccatgacatcattcataaatcattacatgcaatgcaacgatctttgcattttctttttcgagtactgtatgtgtatgatatttgca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1795567 |
agaatgaccccctgccatgacatcattcataaatcattacatgcaatgcaacgatctttgcattttctttttcgagtactgtatgt--atgatatttgca |
1795664 |
T |
|
| Q |
118 |
tatattgattgctggtattttgatttgtgtgattgtcttgagggactgatccaaaaatctacatgacaaaggattgaaaattgggttggaagtcgaccaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1795665 |
tatattgattgctggtattttgatttgtgtgattgtcttgagggactgatccaaaaatctacatgacaaaggattgaaaattgggttggaagtcgaccaa |
1795764 |
T |
|
| Q |
218 |
ctagagaagagctatagttcgactcaaaattcaaccgtttc |
258 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || ||||| |
|
|
| T |
1795765 |
ctagagaagagttatagttcgactcaaaattcgactgtttc |
1795805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University