View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15222_low_14 (Length: 251)
Name: NF15222_low_14
Description: NF15222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15222_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 22 - 245
Target Start/End: Original strand, 24985264 - 24985487
Alignment:
| Q |
22 |
ttaatacctcgaatagtctctggaattttgtctatgtttgacgataggatgggttaggaaatatcttatatctttattattcattgcatgcttgatatgt |
121 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24985264 |
ttaatacctcgaatcgtctctggaattttgtcaatgtttgaagataggatgggttaggaaatatcttatatctttattattcattgcatgcttgatatgt |
24985363 |
T |
|
| Q |
122 |
tttgttgtttaattacgagaacaatgcagaatgtatagtttctgttgtacatgtggttttggatgatagttggtttggataaaccatatctgcaaaactt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
24985364 |
tttgttgtttaattacgagaacaatgcagaatgtatagtttctgttgtacatgtggttttggatgatagatgggttggataaaccatatctgcaaaactt |
24985463 |
T |
|
| Q |
222 |
gcggttggcgaccctctgtgctcc |
245 |
Q |
| |
|
|||||||||| |||| |||||||| |
|
|
| T |
24985464 |
gcggttggcgcccctgtgtgctcc |
24985487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University