View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15222_low_5 (Length: 365)
Name: NF15222_low_5
Description: NF15222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15222_low_5 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 4e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 249 - 365
Target Start/End: Original strand, 2485654 - 2485770
Alignment:
| Q |
249 |
aagagagagacacgtaagaatgcatgcatgagtcagcactagtctccatcctttaaacttgaataagagaagaaaataaagaccgcaccagaaatagcgg |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2485654 |
aagagagagacacgtaagaatgcatgcatgagtcagcactagtctccatcatttaaacttgaataagagaagaaaataaagaccgcaccagaaatagcgg |
2485753 |
T |
|
| Q |
349 |
gaactctcataagatca |
365 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2485754 |
gaactctcataagatca |
2485770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University