View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15223_high_9 (Length: 222)
Name: NF15223_high_9
Description: NF15223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15223_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 99 - 210
Target Start/End: Original strand, 51154218 - 51154328
Alignment:
| Q |
99 |
ttattcaagcaatccaaaccaagaaaataaacaataaccatcaaagtatgagatatcgattctatttcagtatagtgtaaatgtaatttcaaaattgttc |
198 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51154218 |
ttatccaagcaatccaaaccaagaaaataaacaataaccatcaa-gtatgagatatcgattctatttcagtatagtgtaaatgtaatttcaaaattgttc |
51154316 |
T |
 |
| Q |
199 |
tttaggcgccta |
210 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51154317 |
tttaggcgccta |
51154328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University