View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15223_low_5 (Length: 349)
Name: NF15223_low_5
Description: NF15223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15223_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 37 - 169
Target Start/End: Complemental strand, 11282545 - 11282413
Alignment:
| Q |
37 |
ttgagttttggttttgtttcagccaataagggcacgaggattgcatattttaactttgcctagtgttatgaaattagatctatacgatatgatgttgtct |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11282545 |
ttgagttttggttttgtttcagccaataagggcatgaggattgcatattttaactttgcctagtgttatgaaattagatctatacgatatgatgttgtct |
11282446 |
T |
 |
| Q |
137 |
tttattttcaactttcaagacatcattctactt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11282445 |
tttattttcaactttcaagacatcattctactt |
11282413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 211 - 328
Target Start/End: Complemental strand, 11282335 - 11282215
Alignment:
| Q |
211 |
atgaaggtatgggttgatatgattaatt----ttagaaatagggtgtagagttggtaaggtattgctagctgtaaaaccaaatttgaagtgtaaagagta |
306 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11282335 |
atgaaggtatgggttgatatgattaattaattttagaaatagggtgtagagttggtaaggtattgctagctgtaaaaccaaatttgaagtgt-aagagta |
11282237 |
T |
 |
| Q |
307 |
tggtcaagcagctagctatcta |
328 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
11282236 |
tggtcaagcagctagctatcta |
11282215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University