View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15224_high_2 (Length: 488)
Name: NF15224_high_2
Description: NF15224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15224_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 17 - 254
Target Start/End: Original strand, 3452507 - 3452744
Alignment:
| Q |
17 |
actatgcacacgtgtcttccacctgtgtgaccgcttgctatggataaaccaacactcgttgggataactccgccgtgtgaccatgtttctactatcagct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3452507 |
actatgcacacgtgtcttccacctgtgtgaccgcttgctatggataaaccaacactcgttgggataactccgccgtgtgaccatgtttctactatcagct |
3452606 |
T |
|
| Q |
117 |
gagcgttccatcctgctgccatagaggataccagctccgccgcaccggattcgctagaaaggtgattgatggtggttatggcttgaactgtgtcgatgta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3452607 |
gagcgttccatcctgctgccatagaggataccagctccgccgcaccggattcgctagaaaggtgattgatggtggttatcgcttgaactgtgtcgatgta |
3452706 |
T |
|
| Q |
217 |
tgagtttgttgctctctctggggaccatactagtttca |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3452707 |
tgagtttgttgctctctctggggaccatactagtttca |
3452744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 17 - 254
Target Start/End: Original strand, 3462529 - 3462763
Alignment:
| Q |
17 |
actatgcacacgtgtcttccacctgtgtgaccgcttgctatggataaaccaacactcgttgggataactccgccgtgtgaccatgtttctactatcagct |
116 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
3462529 |
actatacacacgtgtcttccaccattgtgaccgcttgctatggataaaccaacactcgttggaataactccgccacatgaccatgtttccactataagct |
3462628 |
T |
|
| Q |
117 |
gagcgttccatcctgctgccatagaggataccagctccgccgcaccggattcgctagaaaggtgattgatggtggttatggcttgaactgtgtcgatgta |
216 |
Q |
| |
|
|||||||||||||||| ||||||| || || | ||||||| |||| ||||| || |||||||| ||||||||| ||||||||||||||| ||||| |
|
|
| T |
3462629 |
gagcgttccatcctgccgccatagctgaaacaaactccgccacaccagattcactgacaaggtgat---tggtggttacggcttgaactgtgtctatgta |
3462725 |
T |
|
| Q |
217 |
tgagtttgttgctctctctggggaccatactagtttca |
254 |
Q |
| |
|
|||||| |||||||||||||||||||| || ||||||| |
|
|
| T |
3462726 |
tgagttagttgctctctctggggaccaaacaagtttca |
3462763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 116; E-Value: 8e-59
Query Start/End: Original strand, 354 - 477
Target Start/End: Original strand, 3452844 - 3452967
Alignment:
| Q |
354 |
ggaagaaatgggtgtagagggttatatttatgggtgttaagggacaaaacatttgacttttcgtctttgggctatgtttcgtaacgtattggattacgat |
453 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3452844 |
ggaagaaatgggtgtagtgggttatatttatgggtgttaagggacaaaacatttgacttttcgtctttgggctatgtttcgtaacgtattggattacgat |
3452943 |
T |
|
| Q |
454 |
agcaagttgcactgttcatctcac |
477 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
3452944 |
agcaagttgcactgttcttctcac |
3452967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University