View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15224_high_9 (Length: 276)
Name: NF15224_high_9
Description: NF15224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15224_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 4997209 - 4996956
Alignment:
| Q |
1 |
gcagggtagcatggaatgtgaggaaatagcattaccaagaaaattggtagcaagtgaaagattttggagtgttggaatatgacagaaattagatggaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4997209 |
gcagggtagcatggaatgtgaggaaatagcattaccaagaaaattcgtagcaagtgaaagattttggagtgttggaatatgacagaaattagatggaaaa |
4997110 |
T |
 |
| Q |
101 |
tcaccataaataccggtttctgtgaggtcgattgatacaacggatttattccacgaatcgcaggttatgcctctccagttacaaggattatgatctgtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4997109 |
tcaccataaataccggtttctgtgaggtcgattgatacaacggatttattccgcgaatcgcaggttatgcctctccagttacaaggattatgatctgtgt |
4997010 |
T |
 |
| Q |
201 |
ttggaagccaatcattgagacttttgtttttgtcatcaatttgtgtgttcttta |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4997009 |
ttggaagccaatcattgagacttttgtttttgtcatcaatttgtgtgttcttta |
4996956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University