View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15224_low_12 (Length: 255)
Name: NF15224_low_12
Description: NF15224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15224_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 49874632 - 49874403
Alignment:
| Q |
16 |
caaatttatggtcatggttttctggactttattttgctttagagtatggtgtatgatttgattatttgtttccatgaaataatttagactcagagaattg |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49874632 |
caaatttatggtcatgattttctggactttattttgctttagagtatggtgtatgatttgattatttgtttccatgaaataatttagactcagagaattg |
49874533 |
T |
|
| Q |
116 |
aatttaatcattttatactgaaaatactattattttgaacagaaaactttgttatgtcatgtgaatgtttgtgcattgggaagtacaatgatatgaattt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49874532 |
aatttaatcattttatactgaaaatactattattttgaactgaaaactttgttatgtcatgtgaatgtttgtgcattgggaagtacaatgatatgaattt |
49874433 |
T |
|
| Q |
216 |
ttaggttttatcaaaatttttgcttctgtg |
245 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
49874432 |
ttaggttttatcaaaatttttgcttttgtg |
49874403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University