View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15224_low_14 (Length: 241)
Name: NF15224_low_14
Description: NF15224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15224_low_14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 65 - 241
Target Start/End: Complemental strand, 45082931 - 45082756
Alignment:
| Q |
65 |
atgactaaaaatcatacataattgcttaaatttacatgatgaggttgttttgctggtgtgtgtgagtaggcatgcaccagccttctattattacaatctg |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45082931 |
atgactaaaaatcatacataattgcttaaatttacatgatgaggttgttttgctg-tgtgtgtgagtaggcatgcaccagccttctattattacaatctg |
45082833 |
T |
 |
| Q |
165 |
gtattgatttatacagccagtgtcaatggttgagtactgtttttgctcatataggcaacaaattatagatagctagc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45082832 |
gtattgatttatacagccagtgtcaatggttgagcactgtttttgctcatataggcaacaaattatagatagctagc |
45082756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University