View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15225_high_7 (Length: 270)
Name: NF15225_high_7
Description: NF15225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15225_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 34747223 - 34746973
Alignment:
| Q |
1 |
gtatgagatttttgttggtgaacagatcgatgtatatccgtgcacaactgcggagactgaattctcaaggtcaagaggactgatgtgagacttaccggtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
34747223 |
gtatgagatttttgttggtgaacagat----gtatatccgtgcacaactgcggagactgaattctcaaggtcaagaggaccgatgtgagacttaccagtg |
34747128 |
T |
 |
| Q |
101 |
attagagcggttagaccggaaggaaggaaagaagagcaattttgagtaacctgttctgctgttgaatttgagccaaaaccactaggccctgcaattcctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34747127 |
attagagcggttagaccggaaggaaggaaagaagagcaattttgagtaacttgttctgctgttgaatttgaaccaaaaccactaggccctgcaattcctg |
34747028 |
T |
 |
| Q |
201 |
ctaagtatctcaatgttgccttcatggaagggctttacctgttttacaatattat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34747027 |
ctaagtatctcaatgttgccttcatggaagggctttacctgttttacaatattat |
34746973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 132 - 201
Target Start/End: Complemental strand, 43689229 - 43689160
Alignment:
| Q |
132 |
aagagcaattttgagtaacctgttctgctgttgaatttgagccaaaaccactaggccctgcaattcctgc |
201 |
Q |
| |
|
||||||||| |||||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43689229 |
aagagcaatgttgagtgacttgttctgcagttgaatttgagccaaaaccactaggccctgcaatgcctgc |
43689160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University