View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15225_low_4 (Length: 378)
Name: NF15225_low_4
Description: NF15225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15225_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 16 - 295
Target Start/End: Complemental strand, 44802861 - 44802582
Alignment:
| Q |
16 |
gtagccagatcgggtcggatgacggtggttcgacccgttcgtgctgcaccagaacagatatcaaagaaggtagaagagagcataaagagtgcacaagaga |
115 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44802861 |
gtagccggatcgggtcggatgacggtggttcgacccgttcgtgctgcaccagaacagatatcaaagaaggttgaagagagcataaagagtgcacaagaga |
44802762 |
T |
|
| Q |
116 |
cgtgtgctgatgacccagttagtggagaatgcgtagcagcatgggatgaagtggaggaactcagtgctgcagcgagtcatgcaagggataggaagaagga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802761 |
cgtgtgctgatgacccagttagtggagaatgcgtagcagcatgggatgaagtggaggaactcagtgctgcagcgagtcatgcaagggataggaagaagga |
44802662 |
T |
|
| Q |
216 |
ttctgaccccttggaggattactgtaaggataaccctgaaaccgacgagtgcaaaacatttgatacctgatttattatga |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802661 |
ttctgaccccttggaggattactgtaaggataaccctgaaaccgacgagtgcaaaacatttgatacctgatttattatga |
44802582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 289 - 378
Target Start/End: Complemental strand, 44802561 - 44802472
Alignment:
| Q |
289 |
attatgagcattgattagtggtactgctgcactttgattgtgtttatttttatatgcatgtttatcttagcatcatacataaatagcatc |
378 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802561 |
attatgagcattgattaatggtactgctgcactttgattgtgtgtatttttatatgcatgtttatcttagcatcatacataaatagcatc |
44802472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University