View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15225_low_6 (Length: 358)
Name: NF15225_low_6
Description: NF15225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15225_low_6 |
 | |
|
| [»] scaffold1445 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1445 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: scaffold1445
Description:
Target: scaffold1445; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 26 - 257
Target Start/End: Complemental strand, 852 - 604
Alignment:
| Q |
26 |
attcattcataactagtttgaaaacagagaagtaaaaatttgaaag-----------------ttgaaacgacgacgttttggtttgatttgaacgtacg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
852 |
attcattcataactagtttgaaaacagagaagtaaaaatttgaaaggaagaataaaagatgagttgaaacgacgacgttttggtttgatttgaacgtacg |
753 |
T |
|
| Q |
109 |
gacggagtaagaaataaagtgtgaagtcatgcaatgcagcagtcgagagagtttgttggttgattgattgatgggtcaatgagattcaaatgaagtgaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
752 |
gacggagtaagaaataaagtgtgaagtcatgcaatgcagcagtcgagagagtttgttggttgattgattgatgggtcaatgagattcaaatgaagtgaaa |
653 |
T |
|
| Q |
209 |
actcactgatacacgttttctgtttttagttacactttctttaaaatac |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
652 |
actcactgatacacgttttctgtttttagttacactttctttaaaatac |
604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University