View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15228_high_20 (Length: 270)
Name: NF15228_high_20
Description: NF15228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15228_high_20 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 10 - 270
Target Start/End: Original strand, 41655682 - 41655942
Alignment:
| Q |
10 |
agcataggcaaaataggggtaggatgaatggccatgcagtatcacagggaaatactcactctggtacatatatgccacaagcccagcaggcttctcagtc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41655682 |
agcataggcaaaataggggtaggatgaatggccatgcagtatcacagggaaatactcactctggtacatatatgccacaagcccagcaggcttctcagtc |
41655781 |
T |
|
| Q |
110 |
agcgatctcttcaagagagtcaagtactcagcaggnnnnnnnnnnnnnnnnnnnnnnnncgagccccacttttcacttagagaacatgtaaatgcttatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
41655782 |
agcgatctcttcaagagagtcaagtactcagcaggttttttctttctttctttctttctcgagccccacttctcacttatagaacatgtaaatgcttatg |
41655881 |
T |
|
| Q |
210 |
cattgcacattctctacacaactatcaggtgtcacagagttcccagtgctacttgtttttc |
270 |
Q |
| |
|
| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41655882 |
cgttgcacattctcgacacaactatcaggtgtcacagagttcccagtgctacttgtttttc |
41655942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University