View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15228_high_25 (Length: 249)

Name: NF15228_high_25
Description: NF15228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15228_high_25
NF15228_high_25
[»] chr5 (2 HSPs)
chr5 (1-237)||(42313880-42314116)
chr5 (33-94)||(23040693-23040754)
[»] chr4 (3 HSPs)
chr4 (33-94)||(42734729-42734790)
chr4 (48-88)||(42762710-42762750)
chr4 (33-78)||(42717111-42717156)


Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 42313880 - 42314116
Alignment:
1 cctacaaagtgtgttggaaaggtggctgctcagatgcagatgtcttagctggttttgaagctgccataagtgacggtggtgatgtgctctcagtttctct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
42313880 cctacaaagtgtgttggaaaggtggctgctcagatgcagatgtcttagctggttttgaagctgccataagtgacggtgttgatgtgctctcagtttctct 42313979  T
101 tggtatgaagactcataacctttttacagattcaatatctacaggttcctttcatgcagtagcaaatggtatagtagtagttgcttctgctggaaattct 200  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42313980 tggtatgaagactcataacctttttacagattcaatatctataggttcctttcatgcagtagcaaatggtatagtagtagttgcttctgctggaaattct 42314079  T
201 ggtccttattttggaactgtttcgaacgtggcacctt 237  Q
    |||||||||||||||||||||||||||||||||||||    
42314080 ggtccttattttggaactgtttcgaacgtggcacctt 42314116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 33 - 94
Target Start/End: Original strand, 23040693 - 23040754
Alignment:
33 gatgcagatgtcttagctggttttgaagctgccataagtgacggtggtgatgtgctctcagt 94  Q
    ||||||||| | || ||||||||||||||||| |||||||| |||| |||||| || |||||    
23040693 gatgcagatattttggctggttttgaagctgcaataagtgatggtgttgatgtactttcagt 23040754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 94
Target Start/End: Original strand, 42734729 - 42734790
Alignment:
33 gatgcagatgtcttagctggttttgaagctgccataagtgacggtggtgatgtgctctcagt 94  Q
    ||||||||| | || |||||||||||||||||||||||||| |||| ||||||||| |||||    
42734729 gatgcagatattttggctggttttgaagctgccataagtgatggtgttgatgtgctttcagt 42734790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 88
Target Start/End: Complemental strand, 42762750 - 42762710
Alignment:
48 gctggttttgaagctgccataagtgacggtggtgatgtgct 88  Q
    |||||||||||||||||||||||||| |||| |||||||||    
42762750 gctggttttgaagctgccataagtgatggtgttgatgtgct 42762710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 33 - 78
Target Start/End: Complemental strand, 42717156 - 42717111
Alignment:
33 gatgcagatgtcttagctggttttgaagctgccataagtgacggtg 78  Q
    ||||||||| | || |||||||||||||||||||||||||| ||||    
42717156 gatgcagatattttggctggttttgaagctgccataagtgatggtg 42717111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University