View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15228_low_16 (Length: 335)
Name: NF15228_low_16
Description: NF15228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15228_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 270
Target Start/End: Complemental strand, 43306901 - 43306636
Alignment:
| Q |
15 |
ataatgaacagaaatggaaaatagcattgattgtaagtaatgccttgttgcata---------atttctacctcatatcatatcctgttaaattgctata |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43306901 |
ataatgaacagaaatggaaaatagcattgattgtaagtaatgccttgttacatagaatgaatgatttctacctcatatcatatcctgttaaattgctata |
43306802 |
T |
 |
| Q |
106 |
atttagtcttcaccattgaatctataaatttaataaaccttttgaagcaaacccgtgtcaataaatctatccattcttagaatatttactttgtttttgt |
205 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43306801 |
agttagtcttcaccattgaatctataaatttaataaaccttttgaagcaaacccgtgtcaattaatctatccattcttagaatatttactttgtttttgt |
43306702 |
T |
 |
| Q |
206 |
taaca-nnnnnnnnnataatgattccactattttatcatattcgagccagtgcaaacaccaacatc |
270 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43306701 |
taacattttttttttataatgattccactattttatcatattcgagccagtgcaaacaccaacatc |
43306636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 274 - 335
Target Start/End: Complemental strand, 43306394 - 43306333
Alignment:
| Q |
274 |
aaataggtaatagagatataacatgatcatcctaatagaaatcgataaatttcatttcactc |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
43306394 |
aaataggtaatagagatataacatgatcatcctaatagaaaacgataaatttcattttactc |
43306333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University