View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15228_low_18 (Length: 329)
Name: NF15228_low_18
Description: NF15228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15228_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 8e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 168 - 292
Target Start/End: Original strand, 32698062 - 32698187
Alignment:
| Q |
168 |
ttataatac-caaaagttattagttaaggaaagaagtagaaaatccaattttgaagtttagaatataaataaataaaaaacgaagtacctttttgggttt |
266 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32698062 |
ttataatacgcaaaagttattagttaaggacagaagtagaaaatccaattttgaagtttagaatataaataaataaaaaacgaagtacctttttgggttt |
32698161 |
T |
|
| Q |
267 |
ctcatgcaatggatttaatcccttca |
292 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32698162 |
ctcatgcaatggatttaatcccttca |
32698187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 91 - 187
Target Start/End: Original strand, 32697945 - 32698042
Alignment:
| Q |
91 |
cctccaaaaaataaggtaataaattatttttgaaat-tttttaggtagttgctgtattttactaatttgttaaatttattataataccaaaagttatt |
187 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32697945 |
cctccaaaaaattaggtaataaataatttttgaaaagtttttaggtagttgttgtattttactaatttgttaaatttattataataccaaaagttatt |
32698042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University