View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15228_low_20 (Length: 293)
Name: NF15228_low_20
Description: NF15228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15228_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 6 - 268
Target Start/End: Original strand, 2313282 - 2313544
Alignment:
| Q |
6 |
gagcgagtaaaatagtggatcaaaactgtaattaaatatttttaattagaattctacaatccaattatgaagattgttgaggttagttattgttgttgta |
105 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||||||| || ||||||| || |||||| |||| ||||||||||||||||||| |
|
|
| T |
2313282 |
gagcgagtaaaatagcggatcaaaactgtaattaaatatttttgattagaatgttataatccaactacaaagattattgaagttagttattgttgttgta |
2313381 |
T |
 |
| Q |
106 |
tgcaggcagtagctcaacatattaggaggacaataacaatgtcaagtacagtagttaccaatttggttggaccagttcaacaaatgtctttggctaatca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2313382 |
tgcaggcagtagctcaacatattaggaggacaataacaatgtcaagtacagtagttaccaatttggttggaccagttcaacaaatgtctttggctaatca |
2313481 |
T |
 |
| Q |
206 |
tcctgtgaaaggcttgtacttcaccttagctggtggtcctgaggtatcatgaattgttatact |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2313482 |
tcctgtgaaaggcttgtacttcaccttagctggtggtcctgaggtatcatgaattgttatact |
2313544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University