View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15228_low_25 (Length: 264)
Name: NF15228_low_25
Description: NF15228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15228_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 27 - 75
Target Start/End: Original strand, 54495773 - 54495821
Alignment:
| Q |
27 |
tgaattagagagcatcctcactgtcatatcatcgccctgacttttcaac |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54495773 |
tgaattagagagcatcctcactgtcatatcatcgccctgacttttcaac |
54495821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 251
Target Start/End: Original strand, 54495829 - 54495896
Alignment:
| Q |
184 |
aatggaatgattcggtcannnnnnncttacaataaaaagcttctgctaatgaattgcatttgttattc |
251 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54495829 |
aatggaatgattcggtcatttttttcttacaataaaaagcttctgctaatgaattgcatctgttattc |
54495896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University