View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15228_low_28 (Length: 251)
Name: NF15228_low_28
Description: NF15228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15228_low_28 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 14 - 251
Target Start/End: Complemental strand, 54496104 - 54495867
Alignment:
| Q |
14 |
cagagaagaggaaaagatagattaatcatcatcagttgtggttgatgttttgaggaatgttcaagcaacatccatggtagactatcttcattacagtatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54496104 |
cagagaagaggaaaagatagattaatcatcatcagttgtggttgatgtttcgaggaatgttcaagcaacatccatggtagactatcttcattacagtatt |
54496005 |
T |
 |
| Q |
114 |
aaccgttgtgttttcaatcaatggccatacgtttgcctctcacttttattgaatcaaattattctcccatattaactgatgagattctgaattgtggtca |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
54496004 |
aaccgttgtgttttcaatcaatgaccatacgtttgcctctcacttttattgaatcaaattattctcccatatgaacagatgagattctgaattgtggtca |
54495905 |
T |
 |
| Q |
214 |
agaaataagaataacaaatgcaattcatcagcagaagc |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
54495904 |
agaaataagaataacagatgcaattcattagcagaagc |
54495867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University