View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15228_low_31 (Length: 240)
Name: NF15228_low_31
Description: NF15228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15228_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 38040085 - 38040277
Alignment:
| Q |
1 |
gtgctatgttgtttaaccattttggcctgattaattannnnnnnn---gccataatggattgcatattattctgccaaaatagttgacattttacatagt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38040085 |
gtgctatgttgtttaaccattttggcctgattaattttttttttttttgccataatggattgcatattattctgccaaaatagttgacattttacatagt |
38040184 |
T |
 |
| Q |
98 |
ccgttgtgatccaaataatttcgatacggcacactctagtctaaagagtggtagaagaaatcagaactctagctgaaatcttatattatatac |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38040185 |
ccgttgtgatccaaataatttcgatacggcacactctagtctaaagagtggtagaagaaatcagaactctagctgaaatcttatattatatac |
38040277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 226
Target Start/End: Original strand, 38040424 - 38040462
Alignment:
| Q |
188 |
tacaagccaattgtttgatctataatattatgtagaaat |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38040424 |
tacaagccaattgtttgatctataatattatgtagaaat |
38040462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University