View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15228_low_32 (Length: 238)
Name: NF15228_low_32
Description: NF15228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15228_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 117 - 221
Target Start/End: Complemental strand, 2312900 - 2312796
Alignment:
| Q |
117 |
tctaacctcttgtcctctgagcttgccttcaatgtccaaaagtgtccctgtaagagccacagctaaggattgttttttcctattgattatgttatgtgta |
216 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2312900 |
tctaacctcttgtcctctgagtttgccttcaatgtccaaaagtgtccctgtaagagccacagctaaggattgttttttcctattgattatgttatgtgta |
2312801 |
T |
|
| Q |
217 |
tcata |
221 |
Q |
| |
|
||||| |
|
|
| T |
2312800 |
tcata |
2312796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University