View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15228_low_41 (Length: 203)
Name: NF15228_low_41
Description: NF15228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15228_low_41 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 41656213 - 41656011
Alignment:
| Q |
1 |
cctccactagatgataatccagatcctttttccatctcacggtggcgcccactaggtacatacttagcttgcccagttctctgcaaatgatacaaacttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41656213 |
cctccactagatgataatccagatcctttttccatctcacggtggcgcccactaggtacatacttagcttgcccagttctctgcaaatgatacgaacttg |
41656114 |
T |
 |
| Q |
101 |
agaaaacagaacagaaatatgtatgaaataaatgtatagaaagggattaaagcacaactttcgaaataaaatacaaacatcttcactattttatatcaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41656113 |
agaaaacagaacagaaatatgtatgaaataaatgtatagaaagggattaaagcacaagtttcgaaataaaatacaaacatcttcactattttatatcaaa |
41656014 |
T |
 |
| Q |
201 |
gac |
203 |
Q |
| |
|
||| |
|
|
| T |
41656013 |
gac |
41656011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University