View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15230_high_17 (Length: 216)
Name: NF15230_high_17
Description: NF15230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15230_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 20 - 209
Target Start/End: Original strand, 34042336 - 34042526
Alignment:
| Q |
20 |
gtgttcagtagcgttggatgatcctgcacagtgacacaaaaatgtgttttccatttagaatttgtttgagtcatatatgaatgaatgatcatcacagttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34042336 |
gtgttcagtagcgttggatgatcctgcacagtgacacaaaaatgtgttttccatttagaatttgttcgagtcatatatgaatgaatgatcatcacagttg |
34042435 |
T |
 |
| Q |
120 |
cagtaaaatgattgatatagac-ttgtataaatcggtaggtttatcaatatgggtccattgttgattgttcaaagtagaataatctaccca |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
34042436 |
cagtaaaatgattgatatagactttgtataaatcggtaggtttatcaatatgggtccattgttgattgttcaaagtagaatagtccaccca |
34042526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University