View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15230_low_16 (Length: 224)
Name: NF15230_low_16
Description: NF15230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15230_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 15 - 206
Target Start/End: Original strand, 41830631 - 41830822
Alignment:
| Q |
15 |
cataggcatactcatgtagttgttgtaatttgcatgttgtatagaaatataggacccttgttgtatattgaaatctttgttaggttcaggtgaggactca |
114 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41830631 |
cataggcatactcatgtagctgttgtaatttgcatgttgtatagaaatataggacccttgttgtatattgaaatctttgttaggttcaggtgaggactca |
41830730 |
T |
 |
| Q |
115 |
tcacttggatttggtgaggttgaagaagacaagttcttaagtcttttctttatagttgaattccaaaagttttttatttcattgtcagttct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41830731 |
tcacttggatttggtgaggttgaagaagacaagttcttaagtcttttctttatagttgaattccaaaagttttttatttcattgtcggttct |
41830822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 142 - 206
Target Start/End: Original strand, 24358388 - 24358452
Alignment:
| Q |
142 |
gacaagttcttaagtcttttctttatagttgaattccaaaagttttttatttcattgtcagttct |
206 |
Q |
| |
|
|||| |||||| |||||||||||||| ||||||||||||||||| || ||||||||||| ||||| |
|
|
| T |
24358388 |
gacatgttcttgagtcttttctttattgttgaattccaaaagttcttgatttcattgtctgttct |
24358452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 206
Target Start/End: Original strand, 5948210 - 5948258
Alignment:
| Q |
158 |
ttttctttatagttgaattccaaaagttttttatttcattgtcagttct |
206 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||| || ||||| |
|
|
| T |
5948210 |
ttttctttatggttgaattccaaaagttttttatctcattatctgttct |
5948258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University