View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15230_low_17 (Length: 217)
Name: NF15230_low_17
Description: NF15230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15230_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 202
Target Start/End: Original strand, 29578960 - 29579142
Alignment:
| Q |
20 |
cataccgactcttggagacaaagtagtgcaaaaagaaacatgtgtttatggactttatgaaggagcttgaaagatcaacaaaagttacatgctctgatga |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29578960 |
catatcgactcttggagacaaagtagtgcaaaaagaaacatgtgtttatggactttatgaaggagcttgaaagatcaacaaaagttacatgctctgatga |
29579059 |
T |
|
| Q |
120 |
cgaaattgatttggaatattttagttttttatcattttcttatcaatttcagtttcctcatgtacttgatgaagctgtctgtg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29579060 |
cgaaattgatttggaatattttagttttttatcattttcttatcaatttcagtttcctcatgtacttgatgaagctgtttgtg |
29579142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University