View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15231_high_13 (Length: 388)
Name: NF15231_high_13
Description: NF15231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15231_high_13 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 97 - 388
Target Start/End: Complemental strand, 16645781 - 16645490
Alignment:
| Q |
97 |
aaatgtccaacttgttatgatcaattaagtattttctagttttggaagatattgtcacatagacatattaagaccctcaagaatcagtatgagtcactct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16645781 |
aaatgtccaacttgttatgatcaattaagtattttctagttttggaagatattgtcacatagacatattaagaccctcaagaatcagtatgagtcactct |
16645682 |
T |
 |
| Q |
197 |
cttatccactttttgatatcaattggttgcctgcatgaatgatttttcacctccgacaagaaatacaggaagagacacgtagtgcttatagtattcaagg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16645681 |
cttatccactttttgatatcaattggttgcttgcatgaatgatttttcacctccgacaagaaatacaggaagagacacgtagtgcttatagtattcaagg |
16645582 |
T |
 |
| Q |
297 |
acttgacatgtgtagccatatcttgttgtttcacaacctaacatatagataatcgcagaactcacgaccctgtgccctaggtgtgtgagcac |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16645581 |
acttgacatgtgtagccatatcttgttgtttcacaacccaacatataaataatcgcagaactcacgaccctgtgccctaggtgtgtaagcac |
16645490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University