View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15231_high_27 (Length: 292)
Name: NF15231_high_27
Description: NF15231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15231_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 26258757 - 26258985
Alignment:
| Q |
1 |
atgcaacattggagtaaatggtagtggattatattatgtggaagagaggattcaaagggagatggttgttatttttagagaggcttttatattgtatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26258757 |
atgcaacattggagtaaatggtagtggattatattatgtggaagagaggattcaaagggagatggttgttatttttagagaggcttttatattgtatgat |
26258856 |
T |
 |
| Q |
101 |
tatgcttttatccttctttggttgtagacaaactactcaatcttgaggttcaaattgaacatagataatagaacgcttgttggttattcaatttcataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26258857 |
tatgcttttatccttctttggttgtagacaaactactcaatcttgaggttcaaattgaacatagataatagaacgcttgttggttattcaatttcataat |
26258956 |
T |
 |
| Q |
201 |
catgcttaagtgattataatctaggattt |
229 |
Q |
| |
|
|||||||||||| |||||||||||||||| |
|
|
| T |
26258957 |
catgcttaagtggttataatctaggattt |
26258985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 291
Target Start/End: Original strand, 2757738 - 2757771
Alignment:
| Q |
258 |
aattacactcacctcccttgaggtctttttaaat |
291 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
2757738 |
aattacactcacctcccttgaggtcttcttaaat |
2757771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University