View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15231_high_31 (Length: 267)
Name: NF15231_high_31
Description: NF15231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15231_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 30 - 158
Target Start/End: Complemental strand, 5657000 - 5656873
Alignment:
| Q |
30 |
aaaggatatcaaaacttttatagctcctctcatatccttaatcttatacattatgacnnnnnnntatacttaaaaaggaaactttaatgaaagaatccca |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5657000 |
aaaggatatcaaaacttttatagctcctctcatatccttaatcttatacattatgacaaaaaa-tatacttaaaaaggaaactttaatgaaagaatccca |
5656902 |
T |
 |
| Q |
130 |
atttttggatatgacagtagaaaatatga |
158 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5656901 |
atttttggatatgacagtagaaaatatga |
5656873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 192 - 267
Target Start/End: Complemental strand, 5656840 - 5656765
Alignment:
| Q |
192 |
ccatgaacatgcccaaaaagatgtcttgtaacggcaaaccaatttatcgttttttaatgagtgtttgtgggttccc |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5656840 |
ccatgaacatgcccaaaaagatgtcttgtaacggcaaaccaatttatcgttttttaatgagtgtttgtgggttccc |
5656765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University