View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15231_high_35 (Length: 258)
Name: NF15231_high_35
Description: NF15231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15231_high_35 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 108 - 258
Target Start/End: Original strand, 44816962 - 44817112
Alignment:
| Q |
108 |
ataaatctgtagagcaaccagttttcattaattatgaactctatctctgacttcaatcactaattatgcaaagcatgactcttttaaagtgtaaagtatc |
207 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44816962 |
ataaatgtgtagagcaaccagttttcattaattatgaactctatctctgacttgaatcactaattatgcaaagcatgactcttttaaagtgtaaagtatc |
44817061 |
T |
|
| Q |
208 |
agttttgaaactaaataagggagtcataacgatagattttattttttaatc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44817062 |
agttttgaaactaaataagggagtcataacgatagattttattttttaatc |
44817112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 10 - 81
Target Start/End: Original strand, 44816864 - 44816935
Alignment:
| Q |
10 |
cagagaaatcagaagacgaagatgacttatggaataaactaaaaaacgtggctgggtaataaagttattgta |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44816864 |
cagagaaatcagaagacgaagatgacttatggaataaactaaaaaacgtggctgggtaataatgttattgta |
44816935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University