View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15231_high_39 (Length: 236)
Name: NF15231_high_39
Description: NF15231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15231_high_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 36262553 - 36262336
Alignment:
| Q |
1 |
gaatctgatgaacatgatgagaagaataaggtttttgattgtgttaaggaagaagaattgaagaaaaacgtgcatggtttttgttttaaggaagagagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36262553 |
gaatctgatgaacatgatgagaagaataaggtttttgattgtgttaaggaagaagaattgaagaaaaacgtgcatggtttttgttttaaggaagagagaa |
36262454 |
T |
 |
| Q |
101 |
ggttttggataccaactcctgctcagattcttgttggacctatgcagtttgcttgctccatatgcagtaagaccttcaatagatacaacaatatgcaggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36262453 |
ggttttggataccaactcctgctcagattcttgttggacctatgcagtttgcttgctccatatgcagtaagaccttcaatagatacaacaatatgcaggt |
36262354 |
T |
 |
| Q |
201 |
tagtaaggttctcaaatt |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36262353 |
tagtaaggttctcaaatt |
36262336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 99 - 204
Target Start/End: Original strand, 19331164 - 19331269
Alignment:
| Q |
99 |
aaggttttggataccaactcctgctcagattcttgttggacctatgcagtttgcttgctccatatgcagtaagaccttcaatagatacaacaatatgcag |
198 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||| || ||||||||||| || ||||| |||||| |
|
|
| T |
19331164 |
aaggttttggataccaactcctgcacagatccttgttggacctatgcaatttgcttgctccatatgcaacaaaaccttcaataggtataacaacatgcag |
19331263 |
T |
 |
| Q |
199 |
gttagt |
204 |
Q |
| |
|
|||||| |
|
|
| T |
19331264 |
gttagt |
19331269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University