View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15231_low_10 (Length: 419)
Name: NF15231_low_10
Description: NF15231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15231_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 276 - 382
Target Start/End: Complemental strand, 6103545 - 6103439
Alignment:
| Q |
276 |
aatgtttggttaagatttttatgttagggaaaggattgattgtgagcatttggtggaataatgtgacggcgacggttagagaggactctgatgaaatttg |
375 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||| |||||| |
|
|
| T |
6103545 |
aatgtttggttaagatttttatgttaaggaaaggattgattgtgagcatttggtggaagaatgtgacggcaacggttagagaggattctgatggaatttg |
6103446 |
T |
|
| Q |
376 |
agagatg |
382 |
Q |
| |
|
||||||| |
|
|
| T |
6103445 |
agagatg |
6103439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 296 - 346
Target Start/End: Complemental strand, 21460755 - 21460705
Alignment:
| Q |
296 |
atgttagggaaaggattgattgtgagcatttggtggaataatgtgacggcg |
346 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||| || |||||||||||| |
|
|
| T |
21460755 |
atgttagggagaggtttgagtgtgagcatttggtgaaagaatgtgacggcg |
21460705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University