View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15231_low_18 (Length: 354)
Name: NF15231_low_18
Description: NF15231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15231_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 9 - 337
Target Start/End: Complemental strand, 37145390 - 37145058
Alignment:
| Q |
9 |
ataattctatgctctttttcgatgatgataacaataacatgaaaccggtatctatcannnnnnnnnnnnnnnnaattaattaagttctcaaattctctta |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37145390 |
ataactctatgctctttttcgatgatgataacaataacatgaaaccggtatctatcattttattttgttttttaattaattaagttctcaaattctctta |
37145291 |
T |
 |
| Q |
109 |
tttgtttggaggagtgattatcaatttgtcatatcatgt----tgatttgttgttgcaataacaggtttcaaatttgggagttacgagtattttggttag |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37145290 |
tttgtttggaggagtgattatcaatttgtcatatcatgtaacatgatttgttgttgcaataacaggtttcaaatttgggagttacgagtattttggttag |
37145191 |
T |
 |
| Q |
205 |
aaatggtttgaatctaggagtatttagagaagggctcacaagattttctcaaaactgggatgcctcaaagaacaagcagaaaaggcgcaagtaaatgttc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37145190 |
aaatggtttgaatctaggagtatttagagaagggctcacaagattttctcaaaactgggatgcctcaaagaacaagcagaaaaggcgcaagtaaatgttc |
37145091 |
T |
 |
| Q |
305 |
tcagaaagcatattcttccaaccttgatgcttg |
337 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
37145090 |
tcagaaagcatattcttccaaccatgatgcttg |
37145058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University