View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15231_low_31 (Length: 286)
Name: NF15231_low_31
Description: NF15231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15231_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 109 - 285
Target Start/End: Original strand, 5656632 - 5656811
Alignment:
| Q |
109 |
ttgtttgcgtggactaaggtttgattaatcaaaggtggcagaatcgagttgttaccaaaaccaaaagtaacacatgag---nnnnnnnncttggagtgca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5656632 |
ttgtttgcgtggactaaggtttgattaatcaaaggtggcagaatcgagttgttaccaaaaccaaaagtaacacatgagtttttttttttcttggagtgca |
5656731 |
T |
 |
| Q |
206 |
tattctttgtcagttccttttcatttagtttatgggagcccacaatcactcattaaaaaacgagaaattggtttgccgtt |
285 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
5656732 |
tattctttgtcagttccttttcattttgtttatgggaacccacaaacactcattaaaaaacgataaattggtttgccgtt |
5656811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 7 - 49
Target Start/End: Original strand, 5656543 - 5656585
Alignment:
| Q |
7 |
ctttctactctttctatttttgctttcaatttcttatgcatat |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5656543 |
ctttctactctttctatttttgctttcaatatcttatgcatat |
5656585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University