View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15231_low_42 (Length: 244)
Name: NF15231_low_42
Description: NF15231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15231_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 101 - 228
Target Start/End: Original strand, 14453459 - 14453601
Alignment:
| Q |
101 |
tcttgccaaatatgtatatcttgtgttgatgagttgtttggtaactcctcattatgtgattcaacatgttttaaaaagtcagaaaat------------- |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14453459 |
tcttgccaaatatgtatatcttgtgttgatgagttgtttggtaactcctcgttatgtgattcaacatgttttaaaaagtcagaaaattgtggctataaac |
14453558 |
T |
|
| Q |
188 |
--tgtggttattcagtatcaaatatcttttgagtaaaagaggt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14453559 |
aatgtggttattcagtatcaaatatcttttgagtaaaagaggt |
14453601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 14452925 - 14452967
Alignment:
| Q |
1 |
ctgggagtagggggtacatgcacccgacagaattggtgactgt |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14452925 |
ctgggagtagggggtacatgcacccgacagaattggtgactgt |
14452967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University